Prev. |  KEGG KO K09105 > 

RIKEN DNA Bank Human Resource - TFE3

Gene ID NCBI Gene 7030 |  KEGG hsa:7030
Gene Symbol TFE3
Protein Name transcription factor binding to IGHM enhancer 3
Synonyms RCCP2|RCCX1|TFEA|bHLHe33
Featured content Mitophagy - human
Ortholog resource in our bank

  TFE3

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY096901 IRAL042E05 pOTB7 BC026027 NM_006521

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE002673 W01A006L09 pENTR-TOPO IRAL042E05 BC026027 NM_006521 done
HGE002675 W01A006L11 pENTR-TOPO IRAL042E05 BC026027 NM_006521 done

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR178174 ARi45H06 pGCAP10 NM_006521.3  
GCCCCCGACGCCGCCCGCCCGCGCAGTGCTAGCTCCATGGCTTAGCGGAGGAGGCGGCAG
HKR203305 ARiS008E09 pGCAP10 NM_006521.3  
GGTGCTAGCTCCANNNCTTAGCGGAGGAGGCGGCAGTGGCGAGCTGGGGGGAGGGGGGAC
HKR205354 ARiS013G10 pGCAP10 NM_006521.3  
GAGTGGCGAGCTGGGGGGAGGGGGGACTCTTATTTTGTTAGGGGGACCGGGCCGAGGCCC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl