Prev. | NRCD Clone P | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP07248

HP ID(1) HP07248
Gene ID(2) 148479
Gene Symbol finder PHF13
Protein Name PHD finger protein 13
RefSeq NM_153812.2
Length of RefSeq (bp) 3670
Chromosome 1p36.31
Reference DDBJ accession
UniGene Hs.516079

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBd21H08 pGCAP10 GGCCCTCCCTCCCGAGACACGAGCCGAACTGGGCGTCAGGTCGGGGAGCCGGTCGGGTTC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl