Prev. | 

RIKEN DNA Bank Human Resource - PHF13

Gene ID NCBI Gene 148479 |  KEGG hsa:148479
Gene Symbol PHF13
Protein Name PHD finger protein 13
Synonyms PHF5|SPOC1
Links

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX027256 IRAK068C08 pCMV-SPORT6 BC032792 NM_153812 Partial
HGY029561 IRAK073P01 pBluescriptR BC038516 NM_153812
HGY088086 IRAL020D14 pOTB7 BC007931 NM_153812
HGY097633 IRAL044B09 pOTB7 BC048202 NM_153812 Partial/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE001124 W01A002N12 pENTR-TOPO IRAK073P01 BC038516 NM_153812  
HGE001126 W01A002N14 pENTR-TOPO IRAK073P01 BC038516 NM_153812  
HGE001128 W01A002N16 pENTR-TOPO IRAK073P01 BC038516 NM_153812  

♦ W series clone contains a stop codon.

GNP_entry_W01A_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR368576 RBd21H08 pGCAP10 NM_153812.2  
GGCCCTCCCTCCCGAGACACGAGCCGAACTGGGCGTCAGGTCGGGGAGCCGGTCGGGTTC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl