Prev. | NRCD Clone C | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP07241

HP ID(1) HP07241
Gene ID(2) 84319
Gene Symbol finder C3orf26
Protein Name chromosome 3 open reading frame 26
RefSeq NM_032359.2
Length of RefSeq (bp) 1226
Chromosome 3q12.1
Reference DDBJ accession
UniGene Hs.655111

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBd21B02 pGCAP10 GACGCCGGCCGCCTGGCTTTGAGACAACGTGATTCTCCGCAGCTGGTCGCCTACCCGTGA
RBd37G03 pGCAP10
RBdS015F05 pGCAP10 GAGTGTCTAGCGGGAGCTCCGCGTGTAGCTACGCCGGCCGCCTGGCTTTGAGACAACGTG
RBdS105B10 pGCAP10 GAGTGTCTAGCGGGAGCTCCGCGTGTAGCTACGCCGGCCGCCTGGCTTTGAGACAACGTG
RBdS132H16 pGCAP10 GGGCCGCCTGGCTTTGAGACAACGTGATTCTCCGCAGCTGGTCGCCTACCCGTGATGTTC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl