Prev. | 

RIKEN DNA Bank Human Resource - CMSS1

Gene ID NCBI Gene 84319 |  KEGG hsa:84319
Gene Symbol CMSS1
Protein Name cms1 ribosomal small subunit homolog
Synonyms C3orf26
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY080807 IRAL002A07 pOTB7 BC006512 NM_032359
HGY083707 IRAL009E11 pOTB7 BC006475 NM_032359 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR368426 RBd21B02 pGCAP10 NM_032359.2  
GACGCCGGCCGCCTGGCTTTGAGACAACGTGATTCTCCGCAGCTGGTCGCCTACCCGTGA
HKR374947 RBd37G03 pGCAP10 NM_032359.2  
HKR406125 RBdS015F05 pGCAP10 NM_032359.2  
GAGTGTCTAGCGGGAGCTCCGCGTGTAGCTACGCCGGCCGCCTGGCTTTGAGACAACGTG
HKR442034 RBdS105B10 pGCAP10 NM_032359.2  
GAGTGTCTAGCGGGAGCTCCGCGTGTAGCTACGCCGGCCGCCTGGCTTTGAGACAACGTG
HKR452984 RBdS132H16 pGCAP10 NM_032359.2  
GGGCCGCCTGGCTTTGAGACAACGTGATTCTCCGCAGCTGGTCGCCTACCCGTGATGTTC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl