Prev. | NRCD Clone P | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP07202

HP ID(1) HP07202
Gene ID(2) 5046
Gene Symbol finder PCSK6
Protein Name proprotein convertase subtilisin/kexin type 6
RefSeq NM_002570.3
Length of RefSeq (bp) 4559
Chromosome 15q26.3
Reference DDBJ accession
UniGene Hs.498494

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBd15F02 pGCAP10 GGCACTCGCATCTCGGGCGCCGCGCGAGCCTGTCGCCGCTATGCCTCCGCGCGCGCCGCC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl