Prev. |  KEGG KO K08672 > 

RIKEN DNA Bank Human Resource - PCSK6

Gene ID NCBI Gene 5046 |  KEGG hsa:5046
Gene Symbol PCSK6
Protein Name proprotein convertase subtilisin/kexin type 6
Synonyms PACE4|SPC4
Ortholog resources KEGG ortholog (KEGG orthology K08672) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Individualy Deposited Resource

Catalog number Name of Resource Description
RDB02938 Human PACE4 cDNA Expression vector of human PACE4
RDB03188 pAxCAhPACE4 (forward) Shuttle vector to generate rAd harbouring humam PACE4 cDNA
RDB03189 pAxCAhPACE4 (reverse) Shuttle vector to generate rAd harbouring humam PACE4 cDNA
RDB03196 pAxCALNLhPACE4 (forward) Shuttle vector to generate rAd harbouring human PACE4 cDNA
RDB03197 pAxCALNLhPACE4 (reverse) Shuttle vector to generate rAd harbouring humam PACE4 cDNA
RDB03207 AxCALNLhPACE4 Recombinant adenovirus harbouring human PACE4 cDNA

RDB_org_190226.csv


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX035047 IRAK087K07 pCMV-SPORT6 BC043562 NM_138319 Partial

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR366122 RBd15F02 pGCAP10 NM_002570.3 done
GGCACTCGCATCTCGGGCGCCGCGCGAGCCTGTCGCCGCTATGCCTCCGCGCGCGCCGCC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.18

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl