RIKEN DNA Bank Human Resource - PCSK6
|
Ortholog resource in our bank PCSK6 External database KEGG gene KEGG Ortholog NCBI Gene |
Individualy Deposited Resource
| Catalog number | Name of Resource | Description |
|---|---|---|
| RDB02938 | Human PACE4 cDNA | Expression vector of human PACE4 |
| RDB03188 | pAxCAhPACE4 (forward) | Shuttle vector to generate rAd harbouring humam PACE4 cDNA |
| RDB03189 | pAxCAhPACE4 (reverse) | Shuttle vector to generate rAd harbouring humam PACE4 cDNA |
| RDB03196 | pAxCALNLhPACE4 (forward) | Shuttle vector to generate rAd harbouring human PACE4 cDNA |
| RDB03197 | pAxCALNLhPACE4 (reverse) | Shuttle vector to generate rAd harbouring humam PACE4 cDNA |
| RDB03207 | AxCALNLhPACE4 | Recombinant adenovirus harbouring human PACE4 cDNA |
webcatalog20220516.tab
Genome Network Project (GNP) Human cDNA Clone
Plasmid request [in Japanese] [in English]
| Catalog number | Clone name | Vector | Sequence submitted (DDBJ)(1) | CDS comparison | |
|---|---|---|---|---|---|
| Refered (NCBI mRNA) | CDS status(2) | ||||
| HGX035047 | IRAK087K07 | pCMV-SPORT6 | BC043562 | NM_138319 | Partial |
(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.
GNP_full_IRAK_2023Jun29.csv
GNP_full_IRAL_2023Jun29.csv
NRCD Human cDNA Clone
Plasmid request [in Japanese] [in English]
| Catalog number | Clone name | Vector | CDS comparison | Status | |
|---|---|---|---|---|---|
| Refered mRNA(1) | CDS status | ||||
| 5'-terminal sequence(2) | |||||
| HKR366122 | RBd15F02 | pGCAP10 | NM_002570.3 |  |
|
| GGCACTCGCATCTCGGGCGCCGCGCGAGCCTGTCGCCGCTATGCCTCCGCGCGCGCCGCC | |||||
♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.
NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv
2023.08.18
Homo_sapiens_gene_info230514.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl