Prev. | NRCD Clone V | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP07199

HP ID(1) HP07199
Gene ID(2) 50853
Gene Symbol finder VILL
Protein Name villin-like
RefSeq NM_015873.3
Length of RefSeq (bp) 2787
Chromosome 3p21.3
Reference DDBJ accession
UniGene Hs.103665

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBd14H06 pGCAP10 GCCCTGCCTAGCGTCTCCCCATGGCCCTTGGTACATCCTCCCCTTCTCCACCCGCACCTC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl