Prev. | NRCD Clone V | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP07193

HP ID(1) HP07193
Gene ID(2) 55823
Gene Symbol finder VPS11
Protein Name vacuolar protein sorting 11 homolog (S. cerevisiae)
RefSeq NM_021729.4
Length of RefSeq (bp) 3279
Chromosome 11q23
Reference DDBJ accession
UniGene Hs.234282

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBd14A09 pGCAP10 GGCCCTGGGCCAAAATGGCGGCCTACCTGCAGTGGCGGCGCTTCGTTTTCTTCGACAAGG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl