Prev. | NRCD Clone T | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP07184

HP ID(1) HP07184
Gene ID(2) 7090
Gene Symbol finder TLE3
Protein Name transducin-like enhancer of split 3 (E(sp1) homolog, Drosophila)
RefSeq NM_005078.2
Length of RefSeq (bp) 5354
Chromosome 15q22
Reference DDBJ accession
UniGene Hs.287362

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBd13C07 pGCAP10 GAGTTCAGACCTCGTGCTCGTCCCCTTCGCCTGTCTGTGTGTGGTATCCGTAGGTCCGGG
RBd85G03 pGCAP10 GGGCAGTTCAGACCTCGTGCTCGTCCCCTTCGCCTGTCTGTGTGTGGTATCCGTAGGTCC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl