Prev. | 

RIKEN DNA Bank Human Resource - TLE3

Gene ID NCBI Gene 7090 |  KEGG hsa:7090
Gene Symbol TLE3
Protein Name TLE family member 3, transcriptional corepressor
Synonyms ESG|ESG3|GRG3|HsT18976
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY029703 IRAK074E07 pBluescriptR BC041831 NM_005078 Partial/var
HGY030687 IRAK076L23 pBluescriptR BC043247 NM_005078 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR365255 RBd13C07 pGCAP10 NM_005078.2  
GAGTTCAGACCTCGTGCTCGTCCCCTTCGCCTGTCTGTGTGTGGTATCCGTAGGTCCGGG
HKR394147 RBd85G03 pGCAP10 NM_005078.2  
GGGCAGTTCAGACCTCGTGCTCGTCCCCTTCGCCTGTCTGTGTGTGGTATCCGTAGGTCC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl