Prev. | NRCD Clone P | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP07178

HP ID(1) HP07178
Gene ID(2) 23369
Gene Symbol finder PUM2
Protein Name pumilio homolog 2 (Drosophila)
RefSeq NM_015317.1
Length of RefSeq (bp) 6111
Chromosome 2p22-p21
Reference DDBJ accession
UniGene Hs.467824

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBd12G07 pGCAP10 CGGCCGGCCGATGGGGGGAGGGGAGGGCAGGCGGCGGTGGCNGCCATGTTGTTGTGAGTC
RBd50B08 pGCAP10 GGGGGGAGGGGAGGGCAGGCGGCGGTGGCAGCCATGTTGTTGTGAGTCTCTGTGTCTCAC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl