Prev. |  KEGG KO K17943 > 

RIKEN DNA Bank Human Resource - PUM2

Gene ID NCBI Gene 23369 |  KEGG hsa:23369
Gene Symbol PUM2
Protein Name pumilio RNA binding family member 2
Synonyms PUMH2|PUML2
Ortholog resource in our bank

  PUM2

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY085756 IRAL014G12 pOTB7 BC024218 NM_015317 Partial/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR364951 RBd12G07 pGCAP10 NM_015317.1  
CGGCCGGCCGATGGGGGGAGGGGAGGGCAGGCGGCGGTGGCNGCCATGTTGTTGTGAGTC
HKR380032 RBd50B08 pGCAP10 NM_015317.1  
GGGGGGAGGGGAGGGCAGGCGGCGGTGGCAGCCATGTTGTTGTGAGTCTCTGTGTCTCAC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl