Prev. | NRCD Clone P | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP07172

HP ID(1) HP07172
Gene ID(2) 403313
Gene Symbol finder PPAPDC2
Protein Name phosphatidic acid phosphatase type 2 domain containing 2
RefSeq NM_203453.2
Length of RefSeq (bp) 3023
Chromosome 9p24.1
Reference DDBJ accession
UniGene Hs.107510

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBd12A04 pGCAP10 GAGGGCCGGGAAGCCTCTGTTTGGTCCGGCCAGGTCCCGGGATCCGGGCCGCCCGCTGCG
RBd74G03 pGCAP10 GGCAGGGCCGGGAAGCCTCTGTTTGGTCCGGCCAGGTCCCGGGATCCGGGCCGCCCGCTG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl