Prev. | 

RIKEN DNA Bank Human Resource - PLPP6

Gene ID NCBI Gene 403313 |  KEGG hsa:403313
Gene Symbol PLPP6
Protein Name phospholipid phosphatase 6
Synonyms PDP1|PPAPDC2|PSDP|bA6J24.6
Links

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY019134 IRAK047N22 pBluescriptR BC038108 NM_203453 Full/var
HGX031216 IRAK078A16 pCMV-SPORT6 BC036833 NM_203453 Partial/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE126401 M01C116A01 pDONR221 2_5-A01 AK074672 NM_203453  
HGE084409 M01C011A09 pDONR221 FLJ03-A05 AK074672 NM_203453  
HGE084457 M01C011C09 pDONR221 FLJ03-A05 AK074672 NM_203453  
HGE084505 M01C011E09 pDONR221 FLJ03-A05 AK074672 NM_203453  
HGE084553 M01C011G09 pDONR221 FLJ03-A05 AK074672 NM_203453  
HGE084601 M01C011I09 pDONR221 FLJ03-A05 AK074672 NM_203453  
HGE084649 M01C011K09 pDONR221 FLJ03-A05 AK074672 NM_203453  
HGE084697 M01C011M09 pDONR221 FLJ03-A05 AK074672 NM_203453  
HGE084745 M01C011O09 pDONR221 FLJ03-A05 AK074672 NM_203453  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR364804 RBd12A04 pGCAP10 NM_203453.2  
GAGGGCCGGGAAGCCTCTGTTTGGTCCGGCCAGGTCCCGGGATCCGGGCCGCCCGCTGCG
HKR389747 RBd74G03 pGCAP10 NM_203453.2  
GGCAGGGCCGGGAAGCCTCTGTTTGGTCCGGCCAGGTCCCGGGATCCGGGCCGCCCGCTG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.08

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl