Prev. | NRCD Clone P | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP07164

HP ID(1) HP07164
Gene ID(2) 170394
Gene Symbol finder PWWP2B
Protein Name PWWP domain containing 2B
RefSeq NM_138499.3
Length of RefSeq (bp) 2626
Chromosome 10q26.3
Reference DDBJ accession
UniGene Hs.527751

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBd11B12 pGCAP10 GGCGGCCTGGGACGCGGCGGGAGCATGGAGCCGCGCGCCGGCTGCCGGCTGCCGGTGCGG
RBdS104A01 pGCAP10 GGGGGGCGGCCTGGGACGCGGCGGGAGCATGGAGCCGCGCGCCGGCTGCCGGCTGCCGGT

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl