Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS104A01

Clone ID RBdS104A01
HP ID HP07164
Gene ID 170394
Gene Symbol PWWP2B
Protein Name PWWP domain containing 2B
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_138499.3
Length of RefSeq (bp) 2626
Chromosome 10q26.3
Reference DDBJ accession
UniGene Hs.527751
5'-terminal sequence GGGGGGCGGCCTGGGACGCGGCGGGAGCATGGAGCCGCGCGCCGGCTGCCGGCTGCCGGT
2011.08.28