Prev. | NRCD Clone T | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP07156

HP ID(1) HP07156
Gene ID(2) 10342
Gene Symbol finder TFG
Protein Name TRK-fused gene
RefSeq NM_006070.4
Length of RefSeq (bp) 2098
Chromosome 3q12.2
Reference DDBJ accession
UniGene Hs.518123

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARi17E08 pGCAP10 GGCGCGAGCCTGCGAGCGAGGTGCGGCGGTCGCGAAGGGCAACCGAGCGGGCCGTGACCA
ARiS198D01 pGCAP10 AGTGNTAATGATGCAACGAGTTTTCAGAGGAAAACTTCTNGAGTAATGATGAAGTAACAA
RBd23H12 pGCAP10 GGATTGGCCGGGGCCCGCGCGAGCCTGCGAGCGAGGTGCGGCGGTCGCGAAGGGCAACCG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl