Prev. |  KEGG KO K09292 > 

RIKEN DNA Bank Human Resource - TFG

Gene ID NCBI Gene 10342 |  KEGG hsa:10342
Gene Symbol TFG
Protein Name trafficking from ER to golgi regulator
Synonyms HMSNP|SPG57|TF6|TRKT3
Ortholog resource in our bank

  TFG

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY082960 IRAL007G16 pOTB7 BC001483 NM_006070 Full
HGY084373 IRAL010P13 pOTB7 BC009241 NM_006070 Full
HGY093232 IRAL033B08 pOTB7 BC023599 NM_006070 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE037737 W01A094F17 pENTR-TOPO IRAL007G16 BC001483 NM_006070  
HGE037741 W01A094F21 pENTR-TOPO IRAL007G16 BC001483 NM_006070  
HGE037743 W01A094F23 pENTR-TOPO IRAL007G16 BC001483 NM_006070  
HGE037771 W01A094H03 pENTR-TOPO IRAL007G16 BC001483 NM_006070  
HGE037775 W01A094H07 pENTR-TOPO IRAL007G16 BC001483 NM_006070  
HGE037779 W01A094H11 pENTR-TOPO IRAL007G16 BC001483 NM_006070  
HGE046815 W01A117A15 pENTR-TOPO IRAL007G16 BC001483 NM_006070  
HGE046817 W01A117A17 pENTR-TOPO IRAL007G16 BC001483 NM_006070  
HGE046819 W01A117A19 pENTR-TOPO IRAL007G16 BC001483 NM_006070  
HGE046821 W01A117A21 pENTR-TOPO IRAL007G16 BC001483 NM_006070  
HGE046823 W01A117A23 pENTR-TOPO IRAL007G16 BC001483 NM_006070  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR166904 ARi17E08 pGCAP10 NM_006070.4  
GGCGCGAGCCTGCGAGCGAGGTGCGGCGGTCGCGAAGGGCAACCGAGCGGGCCGTGACCA
HKR279273 ARiS198D01 pGCAP10 NM_006070.4  
AGTGNTAATGATGCAACGAGTTTTCAGAGGAAAACTTCTNGAGTAATGATGAAGTAACAA
HKR369380 RBd23H12 pGCAP10 NM_006070.4  
GGATTGGCCGGGGCCCGCGCGAGCCTGCGAGCGAGGTGCGGCGGTCGCGAAGGGCAACCG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl