Prev. | NRCD Clone N | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP07155

HP ID(1) HP07155
Gene ID(2) 9918
Gene Symbol finder NCAPD2
Protein Name non-SMC condensin I complex, subunit D2
RefSeq NM_014865.3
Length of RefSeq (bp) 4806
Chromosome 12p13.3
Reference DDBJ accession
UniGene Hs.5719

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARi17E07 pGCAP10 GCCTTTTCATTTCAGCCTGACTGCCGGAATCAGAGCCGCGGGTGAGATCCCCAGCCCTGT
ARi50A03 pGCAP10 GAGAGCCGCGGGTGAGATCCCCAGCCCTGTGAGCCTGTAGGAGTAGAATGGCTCCCCAAA
ARiS109D07 pGCAP10 GCCTTTTCATTTCAGCCTGACTGCCGGAATCAGAGCCGCGGGTGAGATCCCCAGCCCTGT

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl