Prev. | Human A to Z list > N > 

RIKEN DNA Bank Human Resource - NCAPD2

Gene ID (NCBI) 9918
Gene Symbol NCAPD2
Protein Name non-SMC condensin I complex, subunit D2
Synonyms CAP-D2|CNAP1|hCAP-D2
Databases KEGG link 01 |  NCBI Gene link 01
Featured content Ortholog resources in the DNA Bank (KEGG orthology K06677)


Genome Network Project (GNP) Human cDNA Clone link 01

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGX025183 IRAK062P23 pCMV-SPORT6 BC028182 NM_014865

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_170405.csv
GNP_full_IRAL_170405.csv


NRCD Human cDNA Clone link 01

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR166903 ARi17E07 pGCAP10 NM_014865.3  
GCCTTTTCATTTCAGCCTGACTGCCGGAATCAGAGCCGCGGGTGAGATCCCCAGCCCTGT
HKR180003 ARi50A03 pGCAP10 NM_014865.3  
GAGAGCCGCGGGTGAGATCCCCAGCCCTGTGAGCCTGTAGGAGTAGAATGGCTCCCCAAA
HKR243679 ARiS109D07 pGCAP10 NM_014865.3  
GCCTTTTCATTTCAGCCTGACTGCCGGAATCAGAGCCGCGGGTGAGATCCCCAGCCCTGT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2017.06.01

Homo_sapiens_gene_info140110 - RDB_hum_GIxxxxxxxxx_html_170416.pl