Prev. |  KEGG KO K06677 > 

RIKEN DNA Bank Human Resource - NCAPD2

Gene ID NCBI Gene 9918 |  KEGG hsa:9918
Gene Symbol NCAPD2
Protein Name non-SMC condensin I complex subunit D2
Synonyms CAP-D2|CNAP1|MCPH21|hCAP-D2
Ortholog resource in our bank

  NCAPD2

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX025183 IRAK062P23 pCMV-SPORT6 BC028182 NM_014865

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR166903 ARi17E07 pGCAP10 NM_014865.3  
GCCTTTTCATTTCAGCCTGACTGCCGGAATCAGAGCCGCGGGTGAGATCCCCAGCCCTGT
HKR180003 ARi50A03 pGCAP10 NM_014865.3  
GAGAGCCGCGGGTGAGATCCCCAGCCCTGTGAGCCTGTAGGAGTAGAATGGCTCCCCAAA
HKR243679 ARiS109D07 pGCAP10 NM_014865.3  
GCCTTTTCATTTCAGCCTGACTGCCGGAATCAGAGCCGCGGGTGAGATCCCCAGCCCTGT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl