Prev. | NRCD Clone U | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP07154

HP ID(1) HP07154
Gene ID(2) 56893
Gene Symbol finder UBQLN4
Protein Name ubiquilin 4
RefSeq NM_020131.3
Length of RefSeq (bp) 3545
Chromosome 1q21
Reference DDBJ accession
UniGene Hs.283739

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARi17B11 pGCAP10 GGGGCGGCCGGGTGGCGGCGGCGGCATGGCGGAGCCGAGCGGGGCCGAGACGAGGCCCCC
RBd70C05 pGCAP10 GGGGCGGCCGGGTGGCGGCGGCGGCATGGCGGAGCCGAGCGGGGCCGAGACGAGGCCCCC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl