Prev. |  KEGG KO K04523 > 

RIKEN DNA Bank Human Resource - UBQLN4

Gene ID NCBI Gene 56893 |  KEGG hsa:56893
Gene Symbol UBQLN4
Protein Name ubiquilin 4
Synonyms A1U|A1Up|C1orf6|CIP75|UBIN
Ortholog resources KEGG ortholog (KEGG orthology K04523) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX005128 IRAK012N16 pCMV-SPORT6 BC018403 NM_020131 Full
HGX056490 IRAK141D18 pCMV-SPORT6 BC063841 NM_020131

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR166835 ARi17B11 pGCAP10 NM_020131.3  
GGGGCGGCCGGGTGGCGGCGGCGGCATGGCGGAGCCGAGCGGGGCCGAGACGAGGCCCCC
HKR388053 RBd70C05 pGCAP10 NM_020131.3  
GGGGCGGCCGGGTGGCGGCGGCGGCATGGCGGAGCCGAGCGGGGCCGAGACGAGGCCCCC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.17

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl