Prev. | NRCD Clone T | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP07153

HP ID(1) HP07153
Gene ID(2) 113419
Gene Symbol finder TEX261
Protein Name testis expressed sequence 261
RefSeq NM_144582.2
Length of RefSeq (bp) 3381
Chromosome 2p13.3
Reference DDBJ accession
UniGene Hs.516087

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARi17B06 pGCAP10 GGTGTCGCCGGAGCCGAAGCGCGCAGGCCCGTCCCGGTGGCCGGGGAGCGGGCGGGTGGG
ARiS118D18 pGCAP10 GGCACCGTCNTNNTGTCNTCCNCGGGGNGGGNANNCNGCGGCGGCGGCTGCGGTGGCGGC
RBdS014C21 pGCAP10 GAGGCCCGTCCCGGTGGCCGGGGAGCGGGCGGGTGGGGGCGCCATGTGGTTCATGTACCT
RBdS132A22 pGCAP10 GGGCGGCGGCGGCGGCGGTGGCGGCTGTGTGTCGCCGGAGCCGAAGCGCGCAGGCCCGTC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl