Prev. | 

RIKEN DNA Bank Human Resource - TEX261

Gene ID NCBI Gene 113419 |  KEGG hsa:113419
Gene Symbol TEX261
Protein Name testis expressed 261
Synonyms TEG-261
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX005266 IRAK013C18 pCMV-SPORT6 BC010656 NM_144582 Partial
HGY096171 IRAL040H03 pOTB7 BC020251 NM_144582 Partial

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR166830 ARi17B06 pGCAP10 NM_144582.2  
GGTGTCGCCGGAGCCGAAGCGCGCAGGCCCGTCCCGGTGGCCGGGGAGCGGGCGGGTGGG
HKR247290 ARiS118D18 pGCAP10 NM_144582.2  
GGCACCGTCNTNNTGTCNTCCNCGGGGNGGGNANNCNGCGGCGGCGGCTGCGGTGGCGGC
HKR405669 RBdS014C21 pGCAP10 NM_144582.2  
GAGGCCCGTCCCGGTGGCCGGGGAGCGGGCGGGTGGGGGCGCCATGTGGTTCATGTACCT
HKR452822 RBdS132A22 pGCAP10 NM_144582.2  
GGGCGGCGGCGGCGGCGGTGGCGGCTGTGTGTCGCCGGAGCCGAAGCGCGCAGGCCCGTC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl