Prev. | NRCD Clone W | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP07152

HP ID(1) HP07152
Gene ID(2) 8976
Gene Symbol finder WASL
Protein Name Wiskott-Aldrich syndrome-like
RefSeq NM_003941.2
Length of RefSeq (bp) 4430
Chromosome 7q31.3
Reference DDBJ accession
UniGene Hs.143728

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARi16H11 pGCAP10 ATGTTGGATTGTGCGGCCGCCGCCGCCGCTGCGGGAGGGTTGGGGGAGGAGTTGGGAGTT
ARi54H04 pGCAP10 ATGTTGGATTGTGCGGCCGCCGCCGCCGCTGCGGGAGGGTTGGGGGAGGAGTTGGGATTT
RBb42B04 pGCAP1 GAGAGTGCGAGGACAACGACCATCCGGCCCTAGCCTGGCCGGGCGGGTGCCGGGAGCTTC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl