Prev. | Human A to Z list > W > 

RIKEN DNA Bank Human Resource - WASL

Gene ID (NCBI) 8976
Gene Symbol WASL
Protein Name Wiskott-Aldrich syndrome-like
Synonyms N-WASP|NWASP
Databases KEGG link 01 |  NCBI Gene link 01
Featured content Endocytosis (human)


Genome Network Project (GNP) Human Full-Length cDNA Clone link 01

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGY036359 IRAK090O23 pBluescript BC052955 NM_003941 Full

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_160505.csv
GNP_full_IRAL_160505.csv


Genome Network Project (GNP) Gateway® Entry Clone link 01

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE022458 W01A056C10 pENTR-TOPO IRAK090O23 BC052955 NM_003941  
HGE022462 W01A056C14 pENTR-TOPO IRAK090O23 BC052955 NM_003941  
HGE022464 W01A056C16 pENTR-TOPO IRAK090O23 BC052955 NM_003941  

♦ W series clone contains a stop codon.

GNP_entry_W01A_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com/site/us/en/home.html


NRCD Human Full-Legth cDNA Clone link 01

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR166579 ARi16H11 pGCAP10 NM_003941.2  
ATGTTGGATTGTGCGGCCGCCGCCGCCGCTGCGGGAGGGTTGGGGGAGGAGTTGGGAGTT
HKR181772 ARi54H04 pGCAP10 NM_003941.2  
ATGTTGGATTGTGCGGCCGCCGCCGCCGCTGCGGGAGGGTTGGGGGAGGAGTTGGGATTT
HKR336828 RBb42B04 pGCAP1 NM_003941.2  
GAGAGTGCGAGGACAACGACCATCCGGCCCTAGCCTGGCCGGGCGGGTGCCGGGAGCTTC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2016.10.28

Homo_sapiens_gene_info140110 - RDB_hum_GIxxxxxxxxx_html_161013.pl