Prev. | NRCD Clone T | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP07137

HP ID(1) HP07137
Gene ID(2) 6877
Gene Symbol finder TAF5
Protein Name TAF5 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 100kDa
RefSeq NM_006951.3
Length of RefSeq (bp) 3283
Chromosome 10q24-q25.2
Reference DDBJ accession
UniGene Hs.96103

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARi15F08 pGCAP10 GGCTCAGCCGCAAGATGGCGGCGCTGGCGGAGGAGCAGACGGAGGTGGCGGTCAAGCTAG
RBd72H12 pGCAP10 GGTGGCTCAGCCGCAAGATGGCGGCGCTGGCGGAGGAGCAGACGGAGGTGGCGGTCAAGC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl