Prev. |  KEGG KO K03130 > 

RIKEN DNA Bank Human Resource - TAF5

Gene ID NCBI Gene 6877 |  KEGG hsa:6877
Gene Symbol TAF5
Protein Name TATA-box binding protein associated factor 5
Synonyms TAF(II)100|TAF2D|TAFII-100|TAFII100
Ortholog resource in our bank

  TAF5

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY099125 IRAL047N13 pOTB7 BC052268 NM_006951 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR166128 ARi15F08 pGCAP10 NM_006951.3  
GGCTCAGCCGCAAGATGGCGGCGCTGGCGGAGGAGCAGACGGAGGTGGCGGTCAAGCTAG
HKR388980 RBd72H12 pGCAP10 NM_006951.3  
GGTGGCTCAGCCGCAAGATGGCGGCGCTGGCGGAGGAGCAGACGGAGGTGGCGGTCAAGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl