Prev. | NRCD Clone P | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP07134

HP ID(1) HP07134
Gene ID(2) 84295
Gene Symbol finder PHF6
Protein Name PHD finger protein 6
RefSeq NM_032458.2
Length of RefSeq (bp) 4772
Chromosome Xq26.3
Reference DDBJ accession
UniGene Hs.356501

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARi15B04 pGCAP10 ACAAGGGGGGGCGACGTAAGGGCGCTCCGCGAGCCCGTCTCTCCTCGAATGAAAGGAAAC
ARi67B04 pGCAP10 TCTTCCGGCCGACCCCCCGATCCCAGCTTCTGCCGGAGAACCTAGACCGACTTCTTTCTC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl