Prev. | 

RIKEN DNA Bank Human Resource - PHF6

Gene ID NCBI Gene 84295 |  KEGG hsa:84295
Gene Symbol PHF6
Protein Name PHD finger protein 6
Synonyms BFLS|BORJ|CENP-31
Links

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY088699 IRAL021M11 pDNR-LIB BC005994 NM_032335 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR166028 ARi15B04 pGCAP10 NM_032458.2  
ACAAGGGGGGGCGACGTAAGGGCGCTCCGCGAGCCCGTCTCTCCTCGAATGAAAGGAAAC
HKR186828 ARi67B04 pGCAP10 NM_032458.2  
TCTTCCGGCCGACCCCCCGATCCCAGCTTCTGCCGGAGAACCTAGACCGACTTCTTTCTC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl