Prev. | NRCD Clone P | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP07129

HP ID(1) HP07129
Gene ID(2) 8761
Gene Symbol finder PABPC4
Protein Name poly(A) binding protein, cytoplasmic 4 (inducible form)
RefSeq NM_003819.3
Length of RefSeq (bp) 3182
Chromosome 1p32-p36
Reference DDBJ accession
UniGene Hs.169900

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARi14B05 pGCAP10 GCTCTCTCCGCCCCGGGTCGCTGCCGCCTCCGCCGCTTTCGGGCTTCGCAGCCTGAGGAA
ARi67G05 pGCAP10 GCTCTCTCCGCCCCGGGTCGCTGCCGCCTCCGCCGCTTTCGGGCTTCGCAGCCTGAGGAA
ARiS096A20 pGCAP10 GGAAGGGGATTCCCCGTTTAATTTTTTTCCTACTTTGATTTTTTGAAATTTGGAGCTTCG
RBd60D03 pGCAP10 GTCTCTCCGCCCCGGGTCGCTGCCGCCTCCGCCGCTTTCGGGCTTCGCAGCCTGAGGAAA
RBdS083N15 pGCAP10 ATTGCTCTCTCCGCCCCGGGTCGCTGCCGCCTCCGCCGCTTTCGGGCTTCGCAGCCTGAG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl