Prev. |  KEGG KO K13126 > 

RIKEN DNA Bank Human Resource - PABPC4

Gene ID NCBI Gene 8761 |  KEGG hsa:8761
Gene Symbol PABPC4
Protein Name poly(A) binding protein cytoplasmic 4
Synonyms APP-1|APP1|PABP4|iPABP
Ortholog resources KEGG ortholog (KEGG orthology K13126) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX056137 IRAK140F17 pCMV-SPORT6 BC065540 NM_003819 Full/var
HGY067078 IRAK167L14 pBluescriptR BC071591 NM_003819 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE105646 M01C064B22 pDONR221 06_06-H11 BC065540 NM_003819  
HGE105694 M01C064D22 pDONR221 06_06-H11 BC065540 NM_003819  
HGE105742 M01C064F22 pDONR221 06_06-H11 BC065540 NM_003819  
HGE105790 M01C064H22 pDONR221 06_06-H11 BC065540 NM_003819  
HGE105838 M01C064J22 pDONR221 06_06-H11 BC065540 NM_003819  
HGE105886 M01C064L22 pDONR221 06_06-H11 BC065540 NM_003819  
HGE105934 M01C064N22 pDONR221 06_06-H11 BC065540 NM_003819  
HGE105982 M01C064P22 pDONR221 06_06-H11 BC065540 NM_003819  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com/site/us/en/home.html


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR165629 ARi14B05 pGCAP10 NM_003819.3  
GCTCTCTCCGCCCCGGGTCGCTGCCGCCTCCGCCGCTTTCGGGCTTCGCAGCCTGAGGAA
HKR186949 ARi67G05 pGCAP10 NM_003819.3  
GCTCTCTCCGCCCCGGGTCGCTGCCGCCTCCGCCGCTTTCGGGCTTCGCAGCCTGAGGAA
HKR238420 ARiS096A20 pGCAP10 NM_003819.3  
GGAAGGGGATTCCCCGTTTAATTTTTTTCCTACTTTGATTTTTTGAAATTTGGAGCTTCG
HKR384075 RBd60D03 pGCAP10 NM_003819.3  
GTCTCTCCGCCCCGGGTCGCTGCCGCCTCCGCCGCTTTCGGGCTTCGCAGCCTGAGGAAA
HKR433527 RBdS083N15 pGCAP10 NM_003819.3  
ATTGCTCTCTCCGCCCCGGGTCGCTGCCGCCTCCGCCGCTTTCGGGCTTCGCAGCCTGAG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.16

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_190501.pl