Prev. | NRCD Clone B | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP07117

HP ID(1) HP07117
Gene ID(2) 55108
Gene Symbol finder BSDC1
Protein Name BSD domain containing 1
RefSeq NM_018045.5
Length of RefSeq (bp) 4728
Chromosome 1p35.1
Reference DDBJ accession
UniGene Hs.353454

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARi25C01 pGCAP10 AAAATAGTGGTGATGTCATGCAGGCAAGATGGCGGAAGGGGAGGACGTGGGATGGTGGCG
ARi36H12 pGCAP10 GGATGTCATGCAGGCAAGATGGCGGAAGGGGAGGACGTGGGATGGTGGCGGAGCTGGCTG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl