Prev. | 

RIKEN DNA Bank Human Resource - BSDC1

Gene ID NCBI Gene 55108 |  KEGG hsa:55108
Gene Symbol BSDC1
Protein Name BSD domain containing 1
Synonyms -
Links

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX005049 IRAK012K09 pCMV-SPORT6 BC010573 NM_018045 Partial/var
HGY018492 IRAK046D20 pBluescriptR BC028381 NM_018045 Partial/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR170049 ARi25C01 pGCAP10 NM_018045.5  
AAAATAGTGGTGATGTCATGCAGGCAAGATGGCGGAAGGGGAGGACGTGGGATGGTGGCG
HKR174580 ARi36H12 pGCAP10 NM_018045.5  
GGATGTCATGCAGGCAAGATGGCGGAAGGGGAGGACGTGGGATGGTGGCGGAGCTGGCTG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.09

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl