Prev. | NRCD Clone P | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP07109

HP ID(1) HP07109
Gene ID(2) 51105
Gene Symbol finder PHF20L1
Protein Name PHD finger protein 20-like 1
RefSeq NM_016018.4
Length of RefSeq (bp) 6263
Chromosome 8q24.22
Reference DDBJ accession
UniGene Hs.304362

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARi24D05 pGCAP10 GGCCCGGCGTCGCGTCAGGGCTGGCCGGCGGCGGAGGCGGCGGCGGCGGCGGCGATGGCA

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl