Prev. |  KEGG KO K18402 > 

RIKEN DNA Bank Human Resource - PHF20L1

Gene ID NCBI Gene 51105 |  KEGG hsa:51105
Gene Symbol PHF20L1
Protein Name PHD finger protein 20 like 1
Synonyms CGI-72|TDRD20B|URLC1
Ortholog resources KEGG ortholog (KEGG orthology K18402) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX044355 IRAK110O19 pCMV-SPORT6 BC050655 NM_198513 Partial/var
HGY084944 IRAL012F24 pOTB7 BC002822 NM_032205 Partial/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR169677 ARi24D05 pGCAP10 NM_016018.4  
GGCCCGGCGTCGCGTCAGGGCTGGCCGGCGGCGGAGGCGGCGGCGGCGGCGGCGATGGCA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.09

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl