Prev. | NRCD Clone A | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP07099

HP ID(1) HP07099
Gene ID(2) 28976
Gene Symbol finder ACAD9
Protein Name acyl-Coenzyme A dehydrogenase family, member 9
RefSeq NM_014049.4
Length of RefSeq (bp) 2608
Chromosome 3q21.3
Reference DDBJ accession
UniGene Hs.567482

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARi22H06 pGCAP10 GGTGTGTGTGTCCCTGCGGCGCTAAGAAGGGGAGACTGAGGCTGAGGCTGGGGAACATCG
ARi64D07 pGCAP10

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl