Prev. | Human A to Z list > A > 

RIKEN DNA Bank Human Resource - ACAD9

Gene ID (NCBI) 28976
Gene Symbol ACAD9
Protein Name acyl-CoA dehydrogenase family, member 9
Synonyms NPD002
Databases KEGG link 01 |  NCBI Gene link 01


Genome Network Project (GNP) Human Full-Length cDNA Clone link 01

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGY084659 IRAL011K19 pOTB7 BC001817 NM_014049 Partial
HGY088380 IRAL020P20 pOTB7 BC007970 NM_014049
HGY090069 IRAL025C21 pOTB7 BC013354 NM_014049 Full

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_160505.csv
GNP_full_IRAL_160505.csv


NRCD Human Full-Legth cDNA Clone link 01

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1)
5'-terminal sequence(2)
HKR168974 ARi22H06 pGCAP10 NM_014049.4
GGTGTGTGTGTCCCTGCGGCGCTAAGAAGGGGAGACTGAGGCTGAGGCTGGGGAACATCG
HKR185679 ARi64D07 pGCAP10 NM_014049.4

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2016.08.11

Homo_sapiens_gene_info140110 - RDB_hum_GIxxxxxxxxx_html_160505.pl