Prev. |  KEGG KO K15980 > 

RIKEN DNA Bank Human Resource - ACAD9

Gene ID NCBI Gene 28976 |  KEGG hsa:28976
Gene Symbol ACAD9
Protein Name acyl-CoA dehydrogenase family member 9
Synonyms MC1DN20|NPD002
Ortholog resource in our bank

  ACAD9

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY084659 IRAL011K19 pOTB7 BC001817 NM_014049 Partial
HGY088380 IRAL020P20 pOTB7 BC007970 NM_014049
HGY090069 IRAL025C21 pOTB7 BC013354 NM_014049 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR168974 ARi22H06 pGCAP10 NM_014049.4  
GGTGTGTGTGTCCCTGCGGCGCTAAGAAGGGGAGACTGAGGCTGAGGCTGGGGAACATCG
HKR185679 ARi64D07 pGCAP10 NM_014049.4  

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl