Prev. | NRCD Clone B | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP07092

HP ID(1) HP07092
Gene ID(2) 623
Gene Symbol finder BDKRB1
Protein Name bradykinin receptor B1
RefSeq NM_000710.2
Length of RefSeq (bp) 1307
Chromosome 14q32.1-q32.2
Reference DDBJ accession
UniGene Hs.525572

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARi22B05 pGCAP10 GAGCACTTCCCAGAAGAGAAAACTCCTCCAAAAGCAGCTCTCACTATCAGAAAACCCAAC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl