Prev. |  KEGG KO K03915 > 

RIKEN DNA Bank Human Resource - BDKRB1

Gene ID NCBI Gene 623 |  KEGG hsa:623
Gene Symbol BDKRB1
Protein Name bradykinin receptor B1
Synonyms B1BKR|B1R|BDKRB2|BKB1R|BKR1|BRADYB1
Ortholog resources KEGG ortholog (KEGG orthology K03915) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR168829 ARi22B05 pGCAP10 NM_000710.2  
GAGCACTTCCCAGAAGAGAAAACTCCTCCAAAAGCAGCTCTCACTATCAGAAAACCCAAC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2021.03.25

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl