Prev. | Human A to Z list > B > 

RIKEN DNA Bank Human Resource - BDKRB1

Gene ID (NCBI) 623
Gene Symbol BDKRB1
Protein Name bradykinin receptor B1
Synonyms B1BKR|B1R|BDKRB2|BKB1R|BKR1|BRADYB1
Databases KEGG hsa:623 |  NCBI Gene 623
Featured content Ortholog resources in the DNA Bank (KEGG orthology K03915)


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR168829 ARi22B05 pGCAP10 NM_000710.2  
GAGCACTTCCCAGAAGAGAAAACTCCTCCAAAAGCAGCTCTCACTATCAGAAAACCCAAC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2018.03.01

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_180123.pl