Prev. | NRCD Clone P | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP07089

HP ID(1) HP07089
Gene ID(2) 22822
Gene Symbol finder PHLDA1
Protein Name pleckstrin homology-like domain, family A, member 1
RefSeq NM_007350.3
Length of RefSeq (bp) 5913
Chromosome 12q15
Reference DDBJ accession
UniGene Hs.602085

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARi21F08 pGCAP10 GGCCCTTCAGTGAGCGCTCGCAAGAGGACGGCAGAGGCCCGGCAGCTCGGAGCTCCGGGA

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl