Prev. | 

RIKEN DNA Bank Human Resource - PHLDA1

Gene ID NCBI Gene 22822 |  KEGG hsa:22822
Gene Symbol PHLDA1
Protein Name pleckstrin homology like domain family A member 1
Synonyms DT1P1B11|PHRIP|TDAG51
Links

  KEGG gene

  NCBI Gene


Individualy Deposited Resource

Catalog number Name of Resource Description
RDB03815 SEREX clone NGO-St-060 (ID 310, 311) #1 SEREX clone NGO-St-060 (ID 310, 311) #1
RDB06710 pET_hsPHLDA1 Prokaryotic expression vector of human PHLDA1

RDB_org_190226.csv


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX031584 IRAK078P24 pCMV-SPORT6 BC037430 NM_007350
HGX035245 IRAK088B21 pCMV-SPORT6 BC039558 NM_007350
HGY036773 IRAK091P13 pBluescript BC047362 NM_007350
HGX056572 IRAK141H04 pCMV-SPORT6 BC065825 NM_007350
HGY088311 IRAL020M23 pOTB7 BC018929 NM_007350 Partial/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR168528 ARi21F08 pGCAP10 NM_007350.3  
GGCCCTTCAGTGAGCGCTCGCAAGAGGACGGCAGAGGCCCGGCAGCTCGGAGCTCCGGGA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.20

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl