Prev. | NRCD Clone V | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP07084

HP ID(1) HP07084
Gene ID(2) 6845
Gene Symbol finder VAMP7
Protein Name vesicle-associated membrane protein 7
RefSeq NM_005638.4
Length of RefSeq (bp) 2660
Chromosome Xq28 and Yq12
Reference DDBJ accession
UniGene Hs.24167

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARi21A10 pGCAP10 GATGCGGAAGTCAGCGGCGTCCGGTCCCAGCCTCCTCTGGGAGCGGGCAGTTGGCGACCC
ARi30E08 pGCAP10 GATGCGGAAGTCAGCGGCGTCCGGTCCCAGCCTCCTCTGGGAGCGGGCAGTTGGCGACCC
RBd16F10 pGCAP10 TGAGCCTCCTCTGGGAGCGGGCAGTTGGCGACCCTGCACTGACCCGCGTCCCTCCGTCTC
RBdS015O19 pGCAP10 GGGCGTCCGGTCCCAGCCTCCTCTGGGAGCGGGCAGTTGGCGACCCTGCACTGACCCGCG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl