Prev. | NRCD Clone P | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP07074

HP ID(1) HP07074
Gene ID(2) 144100
Gene Symbol finder PLEKHA7
Protein Name pleckstrin homology domain containing, family A member 7
RefSeq NM_175058.3
Length of RefSeq (bp) 4848
Chromosome 11p15.1
Reference DDBJ accession
UniGene Hs.12332

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARi20A10 pGCAP10 GGAACATGGCGGCGGCGACGGTCGGGCGGGACACTTTACCTGAGCATTGGTCCTACGGGG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl