Prev. | 

RIKEN DNA Bank Human Resource - PLEKHA7

Gene ID NCBI Gene 144100 |  KEGG hsa:144100
Gene Symbol PLEKHA7
Protein Name pleckstrin homology domain containing A7
Synonyms -
Links

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX035008 IRAK087I16 pCMV-SPORT6 BC041452 NM_175058 Partial/var
HGY067502 IRAK168M14 pBluescriptR BC071599 NM_175058
HGY097469 IRAL043L05 pOTB7 BC033239 NM_175058 Partial/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE100830 M01C052B06 pDONR221 MGC15-H03 BC033239 ENST00000332954  
HGE100878 M01C052D06 pDONR221 MGC15-H03 BC033239 ENST00000332954  
HGE100926 M01C052F06 pDONR221 MGC15-H03 BC033239 ENST00000332954  
HGE100974 M01C052H06 pDONR221 MGC15-H03 BC033239 ENST00000332954  
HGE101022 M01C052J06 pDONR221 MGC15-H03 BC033239 ENST00000332954  
HGE101070 M01C052L06 pDONR221 MGC15-H03 BC033239 ENST00000332954  
HGE101118 M01C052N06 pDONR221 MGC15-H03 BC033239 ENST00000332954  
HGE101166 M01C052P06 pDONR221 MGC15-H03 BC033239 ENST00000332954  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR168010 ARi20A10 pGCAP10 NM_175058.3  
GGAACATGGCGGCGGCGACGGTCGGGCGGGACACTTTACCTGAGCATTGGTCCTACGGGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl