Prev. | NRCD Clone N | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP07065

HP ID(1) HP07065
Gene ID(2) 51068
Gene Symbol finder NMD3
Protein Name NMD3 homolog (S. cerevisiae)
RefSeq NM_015938.3
Length of RefSeq (bp) 2758
Chromosome 3q26.1
Reference DDBJ accession
UniGene Hs.598836

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARi19A11 pGCAP10 GCTCTGTGGCGGAGACAGCCAGAACTTAAGGCATACAGAACGATGGAGTATATGGCAGAA
RBd40E06 pGCAP10 GTCTGTGGCGGAGACAGCCAGGTTGGCAGCTGACGGGACAGCCGGGGTCTATTTTGTTGC
RBdS105E07 pGCAP10 GGAGAGCATTTCGCTCGCGAGATCTTCTCTGTGGCGGAGACAGCCAGAACTTAAGGCATA
RBdS132K06 pGCAP10 GATTTCGCTCGCGAGATCTTCTCTGTGGCGGAGACAGCCAGAACTTAAGGCATACAGAAC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl