Prev. | Human A to Z list > N > 

RIKEN DNA Bank Human Resource - NMD3

Gene ID (NCBI) 51068
Gene Symbol NMD3
Protein Name NMD3 ribosome export adaptor
Synonyms -
Databases KEGG link 01 |  NCBI Gene link 01
Featured content Ortholog resources in the DNA Bank (KEGG orthology K07562)


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGY087921 IRAL019N09 pDNR-LIB BC013317 NM_015938 Full

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_170405.csv
GNP_full_IRAL_170405.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR167611 ARi19A11 pGCAP10 NM_015938.3  
GCTCTGTGGCGGAGACAGCCAGAACTTAAGGCATACAGAACGATGGAGTATATGGCAGAA
HKR376102 RBd40E06 pGCAP10 NM_015938.3  
GTCTGTGGCGGAGACAGCCAGGTTGGCAGCTGACGGGACAGCCGGGGTCTATTTTGTTGC
HKR442103 RBdS105E07 pGCAP10 NM_015938.3  
GGAGAGCATTTCGCTCGCGAGATCTTCTCTGTGGCGGAGACAGCCAGAACTTAAGGCATA
HKR453046 RBdS132K06 pGCAP10 NM_015938.3  
GATTTCGCTCGCGAGATCTTCTCTGTGGCGGAGACAGCCAGAACTTAAGGCATACAGAAC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2017.08.26

Homo_sapiens_gene_info140110 - RDB_hum_GIxxxxxxxxx_html_170416.pl