Prev. |  KEGG KO K07562 > 

RIKEN DNA Bank Human Resource - NMD3

Gene ID NCBI Gene 51068 |  KEGG hsa:51068
Gene Symbol NMD3
Protein Name NMD3 ribosome export adaptor
Synonyms CGI-07
Ortholog resource in our bank

  NMD3

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY087921 IRAL019N09 pDNR-LIB BC013317 NM_015938 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR167611 ARi19A11 pGCAP10 NM_015938.3  
GCTCTGTGGCGGAGACAGCCAGAACTTAAGGCATACAGAACGATGGAGTATATGGCAGAA
HKR376102 RBd40E06 pGCAP10 NM_015938.3  
GTCTGTGGCGGAGACAGCCAGGTTGGCAGCTGACGGGACAGCCGGGGTCTATTTTGTTGC
HKR442103 RBdS105E07 pGCAP10 NM_015938.3  
GGAGAGCATTTCGCTCGCGAGATCTTCTCTGTGGCGGAGACAGCCAGAACTTAAGGCATA
HKR453046 RBdS132K06 pGCAP10 NM_015938.3  
GATTTCGCTCGCGAGATCTTCTCTGTGGCGGAGACAGCCAGAACTTAAGGCATACAGAAC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl