Prev. | NRCD Clone T | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP07059

HP ID(1) HP07059
Gene ID(2) 1678
Gene Symbol finder TIMM8A
Protein Name translocase of inner mitochondrial membrane 8 homolog A (yeast)
RefSeq NM_004085.3
Length of RefSeq (bp) 1459
Chromosome Xq22.1
Reference DDBJ accession
UniGene Hs.447877

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARi18B07 pGCAP10 GGTGAAGGTCGGTGCGGAGTTCGTCTCTGCAAGCTTGGTCGCCCTGGGATGGATTCCTCC
ARiS087P23 pGCAP10 GAGACACGTGAAGGTCGGTGCGGAGTTCGTCTCTGCAAGCTTGGTCGCCCTGGGATGGAT
ARiS088B12 pGCAP10 GAAAGGTCGGTGCGGAGTTCGTCTCTGCAAGCTTGGTCGCCCTGGGATGGATTCCTCCTC
RBd23E12 pGCAP10 GACGTGAAGGTCGGTGCGGAGTTCGTCTCTGCAAGCTTGGTCGCCCTGGGATGGATTCCT
RBdS013I12 pGCAP10 GAGCTGTGGTTCCGGTTCCGTCGCGGAGACACGTGAAGGTCGGTGCGGAGTTCGTCTCTG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl