Prev. |  KEGG KO K17780 > 

RIKEN DNA Bank Human Resource - TIMM8A

Gene ID NCBI Gene 1678 |  KEGG hsa:1678
Gene Symbol TIMM8A
Protein Name translocase of inner mitochondrial membrane 8A
Synonyms DDP|DDP1|DFN1|MTS|TIM8
Ortholog resource in our bank

  TIMM8A

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY092433 IRAL031B09 pDNR-LIB BC015093 NM_004085 Full
HGY102849 IRAL057C01 pDNR-LIB BC070284 NM_004085 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR167231 ARi18B07 pGCAP10 NM_004085.3  
GGTGAAGGTCGGTGCGGAGTTCGTCTCTGCAAGCTTGGTCGCCCTGGGATGGATTCCTCC
HKR235183 ARiS087P23 pGCAP10 NM_004085.3  
GAGACACGTGAAGGTCGGTGCGGAGTTCGTCTCTGCAAGCTTGGTCGCCCTGGGATGGAT
HKR235236 ARiS088B12 pGCAP10 NM_004085.3  
GAAAGGTCGGTGCGGAGTTCGTCTCTGCAAGCTTGGTCGCCCTGGGATGGATTCCTCCTC
HKR369308 RBd23E12 pGCAP10 NM_004085.3  
GACGTGAAGGTCGGTGCGGAGTTCGTCTCTGCAAGCTTGGTCGCCCTGGGATGGATTCCT
HKR405404 RBdS013I12 pGCAP10 NM_004085.3  
GAGCTGTGGTTCCGGTTCCGTCGCGGAGACACGTGAAGGTCGGTGCGGAGTTCGTCTCTG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl